CBSE EXAMINATION PAPER-2024

Read the passage given below and answer the questions that follow:

In recombinant DNA technology, restriction enzymes are used as they recognize and cut DNA within a specific recognition sequence. BamH I is one such restriction enzyme which binds at the recognition sequence 5 G-G-A-T-C-C 3 and cleaves this sequence between G and G on each strand, whereas Alu I binds at the recognition sequence 5 A-G-C-T 3 and cleaves these sequences between G and C on each strand.

Study the figures given below that depict the comparative age distribution of human populations in Sweden and Rwanda. (International Data Base 2003) and answer the questions that follow :

The part of the ovule that develops into protective coats of a seed after fertilization in a typical flowering plant is:

A Snapdragon plant bearing pink colour flowers is crossed with a Snapdragon plant bearing white colour flowers. The expected phenotypic percentage of the offspring is:

S.L. Miller in 1953, to support the theory of chemical evolution, created conditions in the closed flask that included:

In an experiment, E. coli is grown in a medium containing 14NH₄Cl. (14N is the light isotope of Nitrogen) followed by growing it for six generations in a medium having heavy isotope of nitrogen (15N). After six generations, their DNA was extracted and subjected to CsCl density gradient centrifugation. Identify the correct density (Light/Hybrid/Heavy) and ratio of the bands of DNA in CsCl density gradient centrifugation.

Which disease is the patient suffering from who is showing symptoms such as sustained high fever (39C to 40C), stomach pain, constipation, headache, loss of appetite and weakness?

Which native plasmid did Stanley Cohen and Herbert Boyer use for the construction of the first recombinant DNA?

The population growth curve applicable for a population growing in a geometric fashion, when the resources are not limiting in the habitat will be:

Assertion (A) : Primary transcripts in eukaryotes are subjected to splicing to remove the introns. Reason (R) : Primary transcripts contain both exons and introns and the introns are non-functional in eukaryotes.

Assertion (A) : The chronic use of alcohol by a person leads to cirrhosis. Reason (R) : Alcohol addiction at times becomes the cause of mental and financial distress to the entire family of the addicted person.

Assertion (A) : The zygote gives rise to heart-shaped embryo and subsequently proembryo in most angiosperms. Reason (R) : The zygote is present at the micropylar end of the embryo sac and develops into an embryo.

Assertion (A) : The stirrer facilitates the even mixing of oxygen availability in a bioreactor. Reason (R) : Stirred-tank bioreactors generally have a flat base.

Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow :

mRNA 5 UCAUUACCACGAUUCUUUAAAAGA 3

(a) How many amino acids will be formed from the given codons, if substitution of U by C takes place at the 5th codon ? Explain your answer.

(b) Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth ustify your answer.

With reference to the set-ups (A, B and C) given below, of the electrophoretic separation of a mixture of DNA fragments of varied lengths, answer the questions that follow :

(a) In which one of the two Set-ups, A or B, would you see the DNA fragments separated and why ? Justify your answer.

(b) In Set-up C, which one of the two, I / II, are the bands of longer fragments of DNA ? Justify your answer.

(i) Graphically represent the relationship between species richness and area on a log-log scale for bats and fishes. Write the equation for the relationship as on a logarithmic scale.

(ii) Write the equation for the relationship as on a logarithmic scale.

Draw a longitudinal section of pistil of a flower showing growth of the pollen tube. Label the part :

(a) through which the pollen tube moves down.

(b) the cell wherein the pollen tube releases its contents.

Explain the IUI and IUT methods of assisted reproductive technologies.

Three crosses were carried out in pea plants with respect to flower colour violet/white (V/v) and flower position axial/terminal (A/a). Study in the table the crosses 'a', 'b' and 'c' where parental phenotypes and their F₁ progeny phenotypes are given.

Find the genotypes of each of the parental pairs of crosses 'a', 'b' and 'c'.

A population of snakes lived in a desert with brown sand. Study the drawings given below showing the change in the population from to over time and answer the question that follows. Brown snakes and Grey snakes are represented by alleles A/a (Dominant/recessive).

(a) If the frequency of the recessive trait is 9% in population-one, work out the frequency of homozygous dominant and heterozygous dominant snakes.

(b) Name the mechanism of evolution that must have operated so that population-two evolved from population-one.

(i) List two major reasons for using cow-dung in a biogas plant instead of using domestic sewage.

(ii) Mention one use of the unspent slurry of the biogas plant.

Name the bioactive molecule and its microbial source generally used by physicians to treat the patients for :

(i) Myocardial infarction

(ii) High blood cholesterol level

(iii) Organ transplantation

(i) Give the scientific name of the bacteria widely used in biotechnology to create a GM cotton crop resistant to bollworm attacks.

(ii) Explain how GM cotton crop is able to resist insect attacks.

Describe how fig tree and wasp relationship is a spectacular example of mutualism.

(i) Explain any four devices that flowering plants have developed to encourage cross-pollination.

(ii) Why do plants discourage self-pollination ? State any one reason.

Explain the ovarian and uterine events taking place along with the role of pituitary and ovarian hormones, during menstrual cycle in a normal human female under the following phases :

1. Follicular phase/proliferative phase

2. Luteal phase/secretory phase

3. Menstrual phase

The influence of both the alleles in a heterozygous state is clearly expressed in codominance." Explain with the help of inheritance of ABO blood group in humans.

A group of genes are regulated and expressed together as a unit in lac operon.

(i) "Explain the mechanism of switching 'on' of the structural genes of lar operon.

(ii) "Regulation of lac operon' is referred to be negatively regulated. Justify giving a reason.

(i) Describe the life cycle of Plasmodium from the time it enters the human body till a female Anopheles mosquito bites an infected person.

(ii) Mention the two events of Plasmodium life cycle that occur within the female Anopheles body.

(i) Write two differences between malignant tumor and benign tumor.

(ii) Explain any three diagnostic techniques for the detection of cancer.